shRNA Lentivirus (self-inactivating), pH1-(C11orf52-shRNA-Seq2)(CAT#: LV-SI0706WQ)

This product is a C11orf52-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of C11orf52-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert C11orf52-shRNA-Seq2
Related Target/Protein C11orf52
Region CDS
TargetSeq CAACTTACATTATGCTGACAT
NCBI RefSeq NM_080659
Titer >1*10^10 GC/mL
Related Diseases DNA methylation
Target Gene
Gene ID 91894
Uniprot ID Q96A22

Related Products