shRNA Lentivirus (self-inactivating), pH1-(C12orf32-shRNA-Seq1)(CAT#: LV-SI0899WQ)
This product is a C12orf32-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The C12orf32 gene plays a role in DNA damage response (DDR) signaling upon genotoxic stresses such as ionizing radiation (IR) during the S phase. The expression of C12orf32-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | C12orf32-shRNA-Seq1 |
| Related Target/Protein | C12orf32 |
| Region | CDS |
| TargetSeq | GAAGCTGAGCAGAAGCCAATT |
| NCBI RefSeq | NM_031465 |
| Alternative Names | RHINO; RHNO1; HKMT1188 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | DNA damage response (DDR) |
