shRNA Lentivirus (self-inactivating), pH1-(C16orf62-shRNA-Seq2)(CAT#: LV-SI0987WQ)
This product is a C16orf62-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The C16orf62 gene acts as component of the retriever complex. The expression of C16orf62-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | C16orf62-shRNA-Seq2 |
| Related Target/Protein | C16orf62 |
| Region | CDS |
| TargetSeq | GATAGAGATGATAACTCCGTT |
| NCBI RefSeq | NM_020314 |
| Alternative Names | VPS35L |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Hepatocellular carcinoma |