shRNA Lentivirus (self-inactivating), pH1-(C6orf141-shRNA-Seq3)(CAT#: LV-SI0811WQ)
This product is a C6orf141-shRNA encoding Lentivirus, which is based on HIV-1 serotype. Low C6orf141 Expression is Significantly Associated with a Poor Prognosis in Patients with Oral Cancer. The expression of C6orf141-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | C6orf141-shRNA-Seq3 |
Related Target/Protein | C6orf141 |
Region | CDS |
TargetSeq | GAAAGTGCTCTTTCTCCTGCA |
NCBI RefSeq | NM_153344 |
Titer | >1*10^10 GC/mL |
Related Diseases | Oral Cancer |