shRNA Lentivirus (self-inactivating), pH1-(C9orf23-shRNA-Seq1)(CAT#: LV-SI0818WQ)

This product is a C9orf23-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The C9orf23 gene encodes a protein that appears to belong to a family of evolutionarily related proteins (DUF78), that may share one or more domains in common. The expression of C9orf23-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert C9orf23-shRNA-Seq1
Related Target/Protein C9orf23
Region CDS
TargetSeq CCAATGAGTGTGGTTACCAAC
NCBI RefSeq NM_148178
Alternative Names RPP25L; bA296L22.5
Titer >1*10^10 GC/mL
Target Gene
Gene ID 138716
Uniprot ID Q8N5L8

Related Products