shRNA Lentivirus (self-inactivating), pH1-(Cbwd1-shRNA-Seq5)(CAT#: LV-SI2805WQ)
This product is a Cbwd1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of Cbwd1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | Cbwd1-shRNA-Seq5 |
| Related Target/Protein | Cbwd1 |
| Region | CDS |
| TargetSeq | CTATGATATTCTCTCTGGAAT |
| NCBI RefSeq | NM_146097 |
| Alternative Names | COBP |
| Titer | >1*10^10 GC/mL |
