shRNA Lentivirus (self-inactivating), pH1-(CCDC116-shRNA-Seq1)(CAT#: LV-SI0607WQ)

This product is a CCDC116-shRNA encoding Lentivirus, which is based on HIV-1 serotype. A cis-eQTL genetic variant of the cancer-testis gene CCDC116 is associated with risk of multiple cancers. The expression of CCDC116-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert CCDC116-shRNA-Seq1
Related Target/Protein CCDC116
Region CDS
TargetSeq CAGCAGGTTCACGAAGAAGAA
NCBI RefSeq NM_152612
Titer >1*10^10 GC/mL
Related Diseases colorectal cancer, breast cancer, esophageal cancer, gastric cancer
Target Gene
Gene ID 164592
Uniprot ID Q8IYX3

Related Products