shRNA Lentivirus (self-inactivating), pH1-(CEP170L-shRNA-Seq1)(CAT#: LV-SI0924WQ)

Datasheet

This product is a CEP170L-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of CEP170L-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert CEP170L-shRNA-Seq1
Related Target/Protein CEP170L
Region CDS
TargetSeq GCTCTGAACAACATGGGATTT
NCBI RefSeq NM_153243
Alternative Names FAM68B; CEP170L; KIAA0470L
Titer >1*10^10 GC/mL
Target Gene
Gene ID 645455
Uniprot ID Q96L14

Related Products

Recombinant lentivirus, pU6-(Mouse Cntn6), Overexpression (CAT#:Lenti-GTOH0081WQ) shRNA Lentivirus (self-inactivating), p7SK-(OR5A2-shRNA-Seq1) (CAT#:LV-SI3386WQ) shRNA Lentivirus (self-inactivating), pU6-(LAMP3-shRNA-Seq2) (CAT#:LV-SI0240WQ) shRNA Lentivirus (self-inactivating), pH1-(OR52I1-shRNA-Seq6) (CAT#:LV-SI2518WQ) Recombinant lentivirus, pU6-(Rattus Ftmt), Overexpression (CAT#:Lenti-GTOH0784WQ) shRNA Lentivirus (self-inactivating), pH1-(HEATR2-shRNA-Seq2) (CAT#:LV-SI0887WQ) shRNA Lentivirus (self-inactivating), pU6-(Slfnl1-shRNA-Seq1) (CAT#:LV-SI2337WQ) shRNA Lentivirus (self-inactivating), pU6-(PCMTD1-shRNA-Seq1) (CAT#:LV-SI0075WQ)