shRNA Lentivirus (self-inactivating), pH1-(CEP76-shRNA-Seq2)(CAT#: LV-SI0739WQ)
This product is a CEP76-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The CEP76 gene encodes a centrosomal protein which regulates centriole amplification by limiting centriole duplication to once per cell cycle. The expression of CEP76-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | CEP76-shRNA-Seq2 |
| Related Target/Protein | CEP76 |
| Region | 3UTR |
| TargetSeq | GATATTTGAGACTGTCCAGAA |
| NCBI RefSeq | NM_024899 |
| Alternative Names | C18orf9; HsT1705 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Centriole reduplication |