shRNA Lentivirus (self-inactivating), pH1-(CHRDL2-shRNA-Seq1)(CAT#: LV-SI2376WQ)
This product is a CHRDL2-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The CHRDL2 gene encodes a member of the chordin family of proteins. This gene is expressed in many tissues including osteoblasts, where it is differentially expressed during differentiation. In addition, its expression is upregulated in human osteoarthritic joint cartilage, suggesting a role in adult cartilage regeneration. The expression of CHRDL2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | CHRDL2-shRNA-Seq1 |
| Related Target/Protein | CHRDL2 |
| Region | CDS |
| TargetSeq | CCTGAAGGAGAAACATAAGAA |
| NCBI RefSeq | NM_015424 |
| Alternative Names | BNF1; CHL2 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | osteoarthritis |