shRNA Lentivirus (self-inactivating), pH1-(Csn1s2a-shRNA-Seq3)(CAT#: LV-SI2695WQ)
This product is a Csn1s2a-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of Csn1s2a-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | Csn1s2a-shRNA-Seq3 |
| Related Target/Protein | Csn1s2a |
| Region | CDS |
| TargetSeq | GCGTGTTCTTCCAAACAACTA |
| NCBI RefSeq | NM_007785 |
| Alternative Names | CSN1S2AP; CSN1S2A |
| Titer | >1*10^10 GC/mL |