shRNA Lentivirus (self-inactivating), pH1-(Csrnp1-shRNA-Seq1)(CAT#: LV-SI2614WQ)
This product is a Csrnp1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Csrnp1 gene encodes a protein that localizes to the nucleus and expression of this gene is induced in response to elevated levels of axin. The expression of Csrnp1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | Csrnp1-shRNA-Seq1 |
| Related Target/Protein | Csrnp1 |
| Region | CDS |
| TargetSeq | CTGTGCCAGTGTAAGGATTAA |
| NCBI RefSeq | NM_153287 |
| Alternative Names | AXUD1; URAX1; TAIP-3; CSRNP-1; FAM130B |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Cancer |