shRNA Lentivirus (self-inactivating), pH1-(Ctu2-shRNA-Seq5)(CAT#: LV-SI2642WQ)
This product is a Ctu2-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Ctu2 gene a protein which is involved in the post-transcriptional modification of transfer RNAs (tRNAs) and plays a role in thiolation of uridine residue present at the wobble position in a subset of tRNAs, resulting in enhanced codon reading accuracy. The expression of Ctu2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | Ctu2-shRNA-Seq5 |
| Related Target/Protein | Ctu2 |
| Region | CDS |
| TargetSeq | CCAGGAGTCATCTATGTTGAT |
| NCBI RefSeq | NM_153775 |
| Alternative Names | MFRG; NCS2; UPF0432; C16orf84 |
| Titer | >1*10^10 GC/mL |