shRNA Lentivirus (self-inactivating), pH1-(DDX3X-shRNA-Seq4)(CAT#: LV-SI0505WQ)
This product is a DDX3X-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by DDX3X has ATP-dependent RNA helicase activity and display a high level of RNA-independent ATPase activity. Misregulation of this gene has been implicated in tumorigenesis and alternative splicing results in multiple transcript variants. The expression of DDX3X-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | DDX3X-shRNA-Seq4 |
| Related Target/Protein | DDX3X |
| Region | CDS |
| TargetSeq | CGCTTGGAACAGGAACTCTTT |
| NCBI RefSeq | NM_001356 |
| Alternative Names | DBX; DDX3; HLP2; DDX14; CAP-Rf; MRX102 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | X-linked recessive inheritance |