shRNA Lentivirus (self-inactivating), pH1-(Defb41-shRNA-Seq1)(CAT#: LV-SI3058WQ)

This product is a Defb41-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by OR8D4 gene has bactericidal activity and may play a role in the antimicrobial protection of sperm and urogenital tract epithelia. The expression of Defb41-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Defb41-shRNA-Seq1
Related Target/Protein Defb41
Region CDS
TargetSeq CTGTATCAGATGGAGGAACCA
NCBI RefSeq NM_183124
Alternative Names BD-17; Bd-41; Defb16; Defb17; Gm15386; 9230102D03Rik
Titer >1*10^10 GC/mL
Related Diseases Antimicrobial protection
Target Gene
Gene ID 77673
Uniprot ID Q30KP6

Related Products