shRNA Lentivirus (self-inactivating), pH1-(DZIP1L-shRNA-Seq1)(CAT#: LV-SI0636WQ)
This product is a DZIP1L-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The DZIP1L gene encoded proterin is involved in primary cilium formation. Probably acts as a transition zone protein required for localization of PKD1/PC1 and PKD2/PC2 to the ciliary membrane. The expression of DZIP1L-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | DZIP1L-shRNA-Seq1 |
| Related Target/Protein | DZIP1L |
| Region | CDS |
| TargetSeq | GCCAAGCAGAACTCTACACTA |
| NCBI RefSeq | NM_173543 |
| Alternative Names | PKD5; DZIP2 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Testis cancer |