shRNA Lentivirus (self-inactivating), pH1-(EWSR1-shRNA-Seq3)(CAT#: LV-SI0537WQ)

This product is a EWSR1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The EWSR1 gene encodes a multifunctional protein that is involved in various cellular processes, including gene expression, cell signaling, and RNA processing and transport. The expression of EWSR1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert EWSR1-shRNA-Seq3
Related Target/Protein EWSR1
Region CDS
TargetSeq GACCGCCTATGCAACTTCTTA
NCBI RefSeq NM_005243
Alternative Names EWS; EWS-FLI1; bK984G1.4
Titer >1*10^10 GC/mL
Related Diseases Ewing sarcoma as well as neuroectodermal tumors
Target Gene
Gene ID 2130
Uniprot ID Q01844

Related Products