shRNA Lentivirus (self-inactivating), pH1-(FAM45B-shRNA-Seq1)(CAT#: LV-SI3043WQ)

Datasheet

This product is a FAM45B-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of FAM45B-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert FAM45B-shRNA-Seq1
Related Target/Protein FAM45B
Region 3UTR
TargetSeq CGAAGTGCTATAACTACTTTA
NCBI RefSeq NM_018472
Alternative Names HT011; DENND10P1; FAM45BP
Titer >1*10^10 GC/mL
Target Gene
Gene ID 55855
Uniprot ID Q6NSW5

Related Products

shRNA Lentivirus (self-inactivating), pH1-(Lactb2-shRNA-Seq4) (CAT#:LV-SI2786WQ) Recombinant lentivirus, pU6-(Human KDM1A), Overexpression (CAT#:Lenti-GTOH0470WQ) Recombinant lentivirus, pU6-(Human RBL2 3'UTR), Overexpression (CAT#:Lenti-GTOH0745WQ) Recombinant lentivirus, pU6-(Domestic silkworm EZH2 3'UTR), Overexpression (CAT#:Lenti-GTOH0499WQ) Recombinant lentivirus, pU6-(Human GNAT1), Overexpression (CAT#:Lenti-GTOH0125WQ) shRNA Lentivirus (self-inactivating), pH1-(PRELID2-shRNA-Seq2) (CAT#:LV-SI0798WQ) shRNA Lentivirus (self-inactivating), p7SK-(LRRC47-shRNA-Seq1) (CAT#:LV-SI1447WQ) shRNA Lentivirus (self-inactivating), p7SK-(Poc5-shRNA-Seq1) (CAT#:LV-SI3589WQ)