shRNA Lentivirus (self-inactivating), pH1-(FAM49B-shRNA-Seq2)(CAT#: LV-SI0677WQ)
This product is a FAM49B-shRNA encoding Lentivirus, which is based on HIV-1 serotype. FAM49B is a regulator of mitochondrial function and integrity and also inhibits T-cell activation by repressing RAC1 activity and modulating cytoskeleton reorganization. The expression of FAM49B-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | FAM49B-shRNA-Seq2 |
| Related Target/Protein | FAM49B |
| Region | CDS |
| TargetSeq | GCAAATCGAATGTCTTTGTTT |
| NCBI RefSeq | NM_016623 |
| Alternative Names | L1; BM-009 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Pancreatic ductal adenocarcinoma (PDAC) |