shRNA Lentivirus (self-inactivating), pH1-(FBXL16-shRNA-Seq2)(CAT#: LV-SI2364WQ)
This product is a FBXL16-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by FBXL16 belongs to the F-box protein family and they interact with ubiquitination targets through other protein interaction domains. The expression of FBXL16-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | FBXL16-shRNA-Seq2 |
| Related Target/Protein | FBXL16 |
| Region | 3UTR |
| TargetSeq | GCTGTTGAATCAGAAACAGAT |
| NCBI RefSeq | NM_153350 |
| Alternative Names | Fbl16; C16orf22; c380A1.1 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Ductal Carcinoma |
