shRNA Lentivirus (self-inactivating), pH1-(Fchsd1-shRNA-Seq2)(CAT#: LV-SI2734WQ)

This product is a Fchsd1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by Fchsd1 gene may promotes actin polymerization mediated by SNX9 and WASL. The expression of Fchsd1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Fchsd1-shRNA-Seq2
Related Target/Protein Fchsd1
Region 3UTR
TargetSeq CGGATTTATTGACAGTGAATA
NCBI RefSeq NM_175684
Alternative Names NWK2
Titer >1*10^10 GC/mL
Target Gene
Gene ID 89848
Uniprot ID Q86WN1

Related Products