shRNA Lentivirus (self-inactivating), pH1-(GOLGA3-shRNA-Seq1)(CAT#: LV-SI2705WQ)
This product is a GOLGA3-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The GOLGA3 gene participates in glycosylation and transport of proteins and lipids in the secretory pathway. The expression of GOLGA3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | GOLGA3-shRNA-Seq1 |
| Related Target/Protein | GOLGA3 |
| Region | 3UTR |
| TargetSeq | CCAGAGTTACTTCAGTGCATA |
| NCBI RefSeq | NM_005895 |
| Alternative Names | MEA-2; GCP170 |
| Titer | >1*10^10 GC/mL |