shRNA Lentivirus (self-inactivating), pH1-(Gvin1-shRNA-Seq2)(CAT#: LV-SI2604WQ)
This product is a Gvin1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by Gvin1 gene belongs to the TRAFAC class dynamin-like GTPase superfamily. The expression of Gvin1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | Gvin1-shRNA-Seq2 |
| Related Target/Protein | Gvin1 |
| Region | CDS |
| TargetSeq | GCGTGATTACAGTCAGAATTA |
| NCBI RefSeq | NM_029000 |
| Alternative Names | GVIN1; VLIG1; GVIN1P; VLIG-1; GVINP1 |
| Titer | >1*10^10 GC/mL |