shRNA Lentivirus (self-inactivating), pH1-(Iqcf4-shRNA-Seq1)(CAT#: LV-SI3083WQ)
This product is a Iqcf4-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by Iqcf4 gene has calmodulin binding ability. The expression of Iqcf4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | Iqcf4-shRNA-Seq1 |
| Related Target/Protein | Iqcf4 |
| Region | CDS |
| TargetSeq | GACATAAAGGAAACAAGGAAA |
| NCBI RefSeq | NM_026090 |
| Alternative Names | mtIQ1; 1700042N06Rik |
| Titer | >1*10^10 GC/mL |