shRNA Lentivirus (self-inactivating), pH1-(JMJD8-shRNA-Seq1)(CAT#: LV-SI0654WQ)
This product is a JMJD8-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The JMJD8 gene functions as a positive regulator of TNF-induced NF-kappa-B signaling and regulates angiogenesis and cellular metabolism through interaction with PKM. The expression of JMJD8-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | JMJD8-shRNA-Seq1 |
| Related Target/Protein | JMJD8 |
| Region | CDS |
| TargetSeq | CAATGACACCCTGTACTTCTT |
| NCBI RefSeq | NM_001005920 |
| Alternative Names | PP14397; C16orf20 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Colorectal cancer |