shRNA Lentivirus (self-inactivating), pH1-(KCTD2-shRNA-Seq3)(CAT#: LV-SI0919WQ)
This product is a KCTD2-shRNA encoding Lentivirus, which is based on HIV-1 serotype. KCTD2, an adaptor of Cullin3 E3 ubiquitin ligase, suppresses gliomagenesis by destabilizing c-Myc. The expression of KCTD2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | KCTD2-shRNA-Seq3 |
Related Target/Protein | KCTD2 |
Region | CDS |
TargetSeq | CGGGACAATGAGAACAGAACT |
NCBI RefSeq | NM_015353 |
Titer | >1*10^10 GC/mL |
Related Diseases | Ischaemic Stroke and Alzheimer's Disease |