shRNA Lentivirus (self-inactivating), pH1-(KIAA0513-shRNA-Seq2)(CAT#: LV-SI0745WQ)

This product is a KIAA0513-shRNA encoding Lentivirus, which is based on HIV-1 serotype. KIAA0513, a novel signaling molecule that interacts with modulators of neuroplasticity, apoptosis, and the cytoskeleton. The expression of KIAA0513-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert KIAA0513-shRNA-Seq2
Related Target/Protein KIAA0513
Region CDS
TargetSeq GACTTGGATCAGGAGGAGAAA
NCBI RefSeq NM_014732
Titer >1*10^10 GC/mL
Related Diseases Pancreatic carcinoma
Target Gene
Gene ID 9764
Uniprot ID O60268

Related Products