shRNA Lentivirus (self-inactivating), pH1-(KIAA0802-shRNA-Seq1)(CAT#: LV-SI0682WQ)
This product is a KIAA0802-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The KIAA0802 gene plays a role in the development and maintenance of non-centrosomal microtubule bundles at the lateral membrane in polarized epithelial cells. The expression of KIAA0802-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | KIAA0802-shRNA-Seq1 |
| Related Target/Protein | KIAA0802 |
| Region | CDS |
| TargetSeq | GCTGCTGGAACATGCCTTAAA |
| NCBI RefSeq | NM_015210 |
| Alternative Names | SOGA2; CCDC165; MTCL1 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Microtubules (MTs) growth |