shRNA Lentivirus (self-inactivating), pH1-(KIAA1841-shRNA-Seq2)(CAT#: LV-SI0720WQ)
This product is a KIAA1841-shRNA encoding Lentivirus, which is based on HIV-1 serotype. KIAA1841 is targeted for the nucleus and it predicted to play a role in regulating transcription. The expression of KIAA1841-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | KIAA1841-shRNA-Seq2 |
| Related Target/Protein | KIAA1841 |
| Region | CDS |
| TargetSeq | CCATGCAACATGAACTGTATT |
| NCBI RefSeq | NM_032506 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Lung adenocarcinoma |