shRNA Lentivirus (self-inactivating), pH1-(LOC392563-shRNA-Seq3)(CAT#: LV-SI2416WQ)

Datasheet

This product is a LOC392563-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by LOC392563 gene is a component of the mature neuronal cytoskeleton, and it interacts with the zygosome, which is mediated by neurofilament-related proteins. The expression of LOC392563-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert LOC392563-shRNA-Seq3
Related Target/Protein LOC392563
Region CDS
TargetSeq CCGGATAATTACGATCCGATA
NCBI RefSeq XM_373382
Titer >1*10^10 GC/mL
Related Diseases Neurodegenerative diseases

Related Products

shRNA Lentivirus (self-inactivating), p7SK-(Sval3-shRNA-Seq3) (CAT#:LV-SI3596WQ) shRNA Lentivirus (self-inactivating), pU6-(OR5B12-shRNA-Seq1) (CAT#:LV-SI1649WQ) shRNA Lentivirus (self-inactivating), p7SK-(DDX3Y-shRNA-Seq5) (CAT#:LV-SI1022WQ) Recombinant lentivirus, pU6-(Human S100A12), Overexpression (CAT#:Lenti-GTOH0070WQ) shRNA Lentivirus (self-inactivating), pH1-(PLEKHA6-shRNA-Seq1) (CAT#:LV-SI0888WQ) shRNA Lentivirus (self-inactivating), pU6-(2700050L05Rik-shRNA-Seq1) (CAT#:LV-SI2242WQ) shRNA Lentivirus (self-inactivating), pU6-(Tmem146-shRNA-Seq1) (CAT#:LV-SI1976WQ) Recombinant lentivirus, pU6-(Human CX43(GJA1)), Overexpression (CAT#:Lenti-GTOH0339WQ)