shRNA Lentivirus (self-inactivating), pH1-(LOC440993-shRNA-Seq1)(CAT#: LV-SI1001WQ)

This product is a LOC440993-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of LOC440993-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert LOC440993-shRNA-Seq1
Related Target/Protein LOC440993
Region CDS
TargetSeq GAAGTTGCTACTGTGATGAAT
NCBI RefSeq NM_001013714
Titer >1*10^10 GC/mL
Related Diseases Lung cancer

Related Products