shRNA Lentivirus (self-inactivating), pH1-(LOC441799-shRNA-Seq1)(CAT#: LV-SI2422WQ)

This product is a LOC441799-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of LOC441799-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert LOC441799-shRNA-Seq1
Related Target/Protein LOC441799
Region CDS
TargetSeq CTTGCTAAACATCAAGGTCAA
NCBI RefSeq XM_497554
Titer >1*10^10 GC/mL

Related Products