shRNA Lentivirus (self-inactivating), pH1-(LRRC27-shRNA-Seq2)(CAT#: LV-SI0747WQ)

This product is a LRRC27-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of LRRC27-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert LRRC27-shRNA-Seq2
Related Target/Protein LRRC27
Region CDS
TargetSeq GTCTAACCAAGGAGCTGTGAA
NCBI RefSeq NM_030626
Titer >1*10^10 GC/mL
Target Gene
Gene ID 80313
Uniprot ID Q9C0I9

Related Products