shRNA Lentivirus (self-inactivating), pH1-(LRRN4-shRNA-Seq1)(CAT#: LV-SI2463WQ)
This product is a LRRN4-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The LRRN4 gene may play an important role in hippocampus-dependent long-lasting memory. The expression of LRRN4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | LRRN4-shRNA-Seq1 |
Related Target/Protein | LRRN4 |
Region | CDS |
TargetSeq | CCACACACATCTTTCAAGATA |
NCBI RefSeq | NM_152611 |
Alternative Names | NLRR4; NLRR-4; C20orf75; dJ1056H1.1 |
Titer | >1*10^10 GC/mL |
Related Diseases | Nervous system disease |