shRNA Lentivirus (self-inactivating), pH1-(LSM14B-shRNA-Seq1)(CAT#: LV-SI0920WQ)
This product is a LSM14B-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The LSM14B gene may play a role in control of mRNA translation. The expression of LSM14B-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | LSM14B-shRNA-Seq1 |
| Related Target/Protein | LSM14B |
| Region | CDS |
| TargetSeq | GAATTTAAGAAGAGACCCATA |
| NCBI RefSeq | NM_144703 |
| Alternative Names | FT005; LSM13; FAM61B; RAP55B; C20orf40; bA11M20.3 Expression |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Breast cancer |