shRNA Lentivirus (self-inactivating), pH1-(Med18-shRNA-Seq5)(CAT#: LV-SI2732WQ)

This product is a Med18-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by Med18 gene is a component of the Mediator complex, which is a coactivator for DNA-binding factors that activate transcription via RNA polymerase II. The expression of Med18-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Med18-shRNA-Seq5
Related Target/Protein Med18
Region 3UTR
TargetSeq GAATTAAAGGCGTGCGATAAC
NCBI RefSeq NM_026039
Alternative Names SRB5; p28b
Titer >1*10^10 GC/mL
Target Gene
Gene ID 54797
Uniprot ID Q9BUE0

Related Products