shRNA Lentivirus (self-inactivating), pH1-(MRPL16-shRNA-Seq1)(CAT#: LV-SI0716WQ)
This product is a MRPL16-shRNA encoding Lentivirus, which is based on HIV-1 serotype. Among different species, the MRPL16 encoded proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. The expression of MRPL16-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | MRPL16-shRNA-Seq1 |
| Related Target/Protein | MRPL16 |
| Region | 3UTR |
| TargetSeq | GTGTAGGAGATAACTGTATAT |
| NCBI RefSeq | NM_017840 |
| Alternative Names | L16mt; MRP-L16; PNAS-111 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Colorectal cancers |