shRNA Lentivirus (self-inactivating), pH1-(MTRF1L-shRNA-Seq1)(CAT#: LV-SI0867WQ)
This product is a MTRF1L-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by MTRF1L gene plays a role in mitochondrial translation termination, and is thought to be a release factor that is involved in the dissociation of the complete protein from the final tRNA, the ribosome, and the cognate mRNA. The expression of MTRF1L-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | MTRF1L-shRNA-Seq1 |
| Related Target/Protein | MTRF1L |
| Region | CDS |
| TargetSeq | CGGGTCACAGATCACAGAATA |
| NCBI RefSeq | NM_019041 |
| Alternative Names | MRF1L; HMRF1L; mtRF1a |
| Titer | >1*10^10 GC/mL |
