shRNA Lentivirus (self-inactivating), pH1-(N4bp2l2-shRNA-Seq4)(CAT#: LV-SI2769WQ)
This product is a N4bp2l2-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The N4bp2l2 gene has enzyme binding and transcription corepressor activity. The expression of N4bp2l2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | N4bp2l2-shRNA-Seq4 |
| Related Target/Protein | N4bp2l2 |
| Region | CDS |
| TargetSeq | GTTTGATCAGAACGATGAATA |
| NCBI RefSeq | NM_201369 |
| Alternative Names | CG005; CG016; PFAAP5; 92M18.3 |
| Titer | >1*10^10 GC/mL |