shRNA Lentivirus (self-inactivating), pH1-(Olfr1113-shRNA-Seq1)(CAT#: LV-SI3202WQ)

This product is a Olfr1113-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Olfr1113 gene encodes a olfactory receptor protein that interacts with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The expression of Olfr1113-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Olfr1113-shRNA-Seq1
Related Target/Protein Olfr1113
Region CDS
TargetSeq GATCAGCTAGTATCACCTATT
NCBI RefSeq NM_207565
Alternative Names MOR264-25
Titer >1*10^10 GC/mL
Related Diseases Olfactory dysfunction
Target Gene
Gene ID 404327
Uniprot ID Q7TR54

Related Products