shRNA Lentivirus (self-inactivating), pH1-(Olfr1477-shRNA-Seq1)(CAT#: LV-SI3119WQ)

This product is a Olfr1477-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Olfr1477 gene encodes a olfactory receptor protein that interacts with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The expression of Olfr1477-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Olfr1477-shRNA-Seq1
Related Target/Protein Olfr1477
Region CDS
TargetSeq CCTGCAAACTCCTTTATTTAT
NCBI RefSeq NM_146696
Alternative Names MOR202-10
Titer >1*10^10 GC/mL
Related Diseases Olfactory dysfunction
Target Gene
Gene ID 258691
Uniprot ID Q7TQQ7

Related Products