shRNA Lentivirus (self-inactivating), pH1-(Olfr266-shRNA-Seq1)(CAT#: LV-SI3158WQ)

This product is a Olfr266-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Olfr266 gene encodes a olfactory receptor protein that interacts with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The expression of Olfr266-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Olfr266-shRNA-Seq1
Related Target/Protein Olfr266
Region CDS
TargetSeq CTGCATGGATACTTCACTGAT
NCBI RefSeq NM_146489
Alternative Names MOR122-2
Titer >1*10^10 GC/mL
Related Diseases Olfactory dysfunction
Target Gene
Gene ID 258482
Uniprot ID Q8VFC3

Related Products