shRNA Lentivirus (self-inactivating), pH1-(PATL1-shRNA-Seq3)(CAT#: LV-SI0606WQ)
This product is a PATL1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The PATL1 gene encodes a involved in deadenylation-dependent decapping of mRNAs, leading to the degradation of mRNAs. Acts as a scaffold protein that connects deadenylation and decapping machinery. The expression of PATL1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | PATL1-shRNA-Seq3 |
| Related Target/Protein | PATL1 |
| Region | 3UTR |
| TargetSeq | GCCATCACCAATGGAGTGTTT |
| NCBI RefSeq | NM_152716 |
| Alternative Names | Pat1b; hPat1b |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Hepatitis C virus (HCV) infection |