shRNA Lentivirus (self-inactivating), pH1-(Patl2-shRNA-Seq1)(CAT#: LV-SI3171WQ)

This product is a Patl2-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Patl2 gene encodes a RNA-binding protein that acts as a translational repressor. The expression of Patl2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Patl2-shRNA-Seq1
Related Target/Protein Patl2
Region CDS
TargetSeq CAGGGTTGAGTTTCTCCAGTT
NCBI RefSeq NM_026251
Alternative Names OOMD4; Pat1a; hPat1a
Titer >1*10^10 GC/mL
Target Gene
Gene ID 197135
Uniprot ID C9JE40

Related Products