shRNA Lentivirus (self-inactivating), pH1-(PLEKHM1-shRNA-Seq1)(CAT#: LV-SI0931WQ)
This product is a PLEKHM1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by PLEKHM1 gene is essential for bone resorption, and may play a critical role in vesicular transport in the osteoclast. The expression of PLEKHM1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | PLEKHM1-shRNA-Seq1 |
| Related Target/Protein | PLEKHM1 |
| Region | 3UTR |
| TargetSeq | GCCAGTGCTTTCAGATGCATT |
| NCBI RefSeq | NM_014798 |
| Alternative Names | B2; AP162; OPTA3; OPTB6 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Autosomal recessive osteopetrosis type 6 (OPTB6) |