shRNA Lentivirus (self-inactivating), pH1-(Pramel1-shRNA-Seq1)(CAT#: LV-SI3149WQ)

Datasheet

This product is a Pramel1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Pramel1 gene may play a role in acrosome development and also in sperm maturation and motility. The expression of Pramel1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Pramel1-shRNA-Seq1
Related Target/Protein Pramel1
Region CDS
TargetSeq CTACAGGAGAATCTTAGAGAT
NCBI RefSeq NM_031377
Titer >1*10^10 GC/mL
Related Diseases Infertility
Target Gene
Gene ID 83491
Uniprot ID Q99MW3

Related Products

Recombinant lentivirus, pU6-(Human CBLB), Overexpression (CAT#:Lenti-GTOH0758WQ) shRNA Lentivirus (self-inactivating), pH1-(Ola1-shRNA-Seq2) (CAT#:LV-SI2586WQ) shRNA Lentivirus (self-inactivating), p7SK-(YPEL3-shRNA-Seq3) (CAT#:LV-SI1160WQ) shRNA Lentivirus (self-inactivating), pH1-(GEMIN8-shRNA-Seq2) (CAT#:LV-SI0671WQ) shRNA Lentivirus (self-inactivating), pU6-(CCDC84-shRNA-Seq1) (CAT#:LV-SI2340WQ) Recombinant lentivirus, pU6-(Human GDF-15), Overexpression (CAT#:Lenti-GTOH0322WQ) Recombinant lentivirus, pU6-(Human hsa-mir-574), Overexpression (CAT#:Lenti-GTOH0206WQ) shRNA Lentivirus (self-inactivating), pH1-(C12orf48-shRNA-Seq1) (CAT#:LV-SI0773WQ)