shRNA Lentivirus (self-inactivating), pH1-(Prr13-shRNA-Seq1)(CAT#: LV-SI3163WQ)

This product is a Prr13-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by Prr13 gene may negatively regulate TSP1 expression at the level of transcription. The expression of Prr13-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Prr13-shRNA-Seq1
Related Target/Protein Prr13
Region CDS
TargetSeq GAAGTCGCACAAGCATCACAA
NCBI RefSeq NM_025385
Alternative Names TXR1
Titer >1*10^10 GC/mL
Target Gene
Gene ID 54458
Uniprot ID Q9NZ81

Related Products