shRNA Lentivirus (self-inactivating), pH1-(RBM33-shRNA-Seq5)(CAT#: LV-SI2959WQ)
This product is a RBM33-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of RBM33-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | RBM33-shRNA-Seq5 |
Related Target/Protein | RBM33 |
Region | CDS |
TargetSeq | GCTTAAAGATAGAAGAACAGA |
NCBI RefSeq | NM_053043 |
Alternative Names | PRR8 |
Titer | >1*10^10 GC/mL |