shRNA Lentivirus (self-inactivating), pH1-(RNPS1-shRNA-Seq5)(CAT#: LV-SI0554WQ)

This product is a RNPS1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The RNPS1 gene encodes a protein that is part of a post-splicing multiprotein complex involved in both mRNA nuclear export and mRNA surveillance. The expression of RNPS1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert RNPS1-shRNA-Seq5
Related Target/Protein RNPS1
Region CDS
TargetSeq CGTAGAGTTTGAGAATCCAGA
NCBI RefSeq NM_006711
Alternative Names E5.1
Titer >1*10^10 GC/mL
Related Diseases Neuro-developmental disorders
Target Gene
Gene ID 10921
Uniprot ID Q15287

Related Products