shRNA Lentivirus (self-inactivating), pH1-(RPRM-shRNA-Seq2)(CAT#: LV-SI0912WQ)
This product is a RPRM-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The RPRM gene may be involved in the regulation of p53-dependent G2 arrest of the cell cycle. The expression of RPRM-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | RPRM-shRNA-Seq2 |
| Related Target/Protein | RPRM |
| Region | 3UTR |
| TargetSeq | GAACTTTGGAAGCTGCTACTT |
| NCBI RefSeq | NM_019845 |
| Alternative Names | REPRIMO |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Lung carcinoma |